plasmid pci sep glur2 q Search Results


plasmid pci sep glur2 q  (Addgene inc)
92
Addgene inc plasmid pci sep glur2 q
a , Schematic depicting AMPAR channel trafficking downstream of BDNF-TrkB signaling. BDNF-TrkB induces activation of Ca 2+ /calmodulin-dependent kinase II (CAMKII) and protein kinase C (PKC), which phosphorylates AMPAR subunits and increases synaptic delivery . b , Western blot analysis of cell membrane surface and total cell protein from SU-DIPGVI cells treated with 100nM BDNF for 30mins. Surface proteins were labelled with Biotin and extracted from total protein with Avidin bead pull-down. Right, quantification of % of biotinylated cell surface proteins from total ( n = 4 biological replicates). c, Super ecliptic pHluorin tagged GluA subunit (GluA-SEP). d-e, Validation of pHluorin. d, Left, confocal image of a glioma cell expressing the calcium permeable AMPAR subunit tagged with SEP <t>(GluA2(Q)-SEP),</t> PSD95-RFP and whole cell TagBFP, in co-culture with neurons. Right, individual representative puncta of <t>GluA2(Q)-SEP.</t> Scale bars = 5µm and 1µm, respectively. Cells were perfused with pH 7.4 aCSF followed by exposure to aCSF containing membrane impermeable acid at pH 5.5 and then returned to pH 7.4. e, Quantification of GluA2(Q)-SEP puncta intensities before, during and after acidic aCSF exposure, as a ratio to PSD95-RFP puncta intensity ( n = 4 puncta, one cell). f , confocal images of two representative GluA2(Q)-SEP; PSD95-RFP, TAG-BFP expressing glioma cells in co-culture with neurons. Co-localized puncta intensity was measured over a time course with BDNF (100nM) perfusion. g, Left, quantification of GluA2(Q)-SEP / PSD95-RFP puncta intensities over time with BDNF as compared to initial baseline intensity ( n = 8 puncta, 6 cells). Right, quantification of one 15-minute time point with control cells (vehicle, n = 4 puncta, 2 cells) vs BDNF treatment (100nM, n = 8 puncta, 6 cells). h, Representative Western blot analysis of primary patient-derived glioma culture, SU-DIPGVI, treated with 100nM recombinant BDNF at several timepoints using indicated antibodies. Right, quantification of the phospho-immunoblots ratio to corresponding total protein levels and normalized to vehicle treated control ( y axis is in arbitrary units, n = 3 biological replicates). i , Representative Western blot analysis of 100nM BDNF treated glioma cells (as in h ,) at 30mins with and without entrectinib (5µM). Right, quantification of phospho-immunoblots (as in h , y axis is in arbitrary units, n = 3 biological replicates). Data are mean ± s.e.m. *P< 0.05, **P< 0.01, two-tailed paired Student’s t -test for b , e , One sample t and Wilcoxon test for g (left panel), h and i . Unpaired t-test for g (right panel).
Plasmid Pci Sep Glur2 Q, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid pci sep glur2 q/product/Addgene inc
Average 92 stars, based on 1 article reviews
plasmid pci sep glur2 q - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

Image Search Results


a , Schematic depicting AMPAR channel trafficking downstream of BDNF-TrkB signaling. BDNF-TrkB induces activation of Ca 2+ /calmodulin-dependent kinase II (CAMKII) and protein kinase C (PKC), which phosphorylates AMPAR subunits and increases synaptic delivery . b , Western blot analysis of cell membrane surface and total cell protein from SU-DIPGVI cells treated with 100nM BDNF for 30mins. Surface proteins were labelled with Biotin and extracted from total protein with Avidin bead pull-down. Right, quantification of % of biotinylated cell surface proteins from total ( n = 4 biological replicates). c, Super ecliptic pHluorin tagged GluA subunit (GluA-SEP). d-e, Validation of pHluorin. d, Left, confocal image of a glioma cell expressing the calcium permeable AMPAR subunit tagged with SEP (GluA2(Q)-SEP), PSD95-RFP and whole cell TagBFP, in co-culture with neurons. Right, individual representative puncta of GluA2(Q)-SEP. Scale bars = 5µm and 1µm, respectively. Cells were perfused with pH 7.4 aCSF followed by exposure to aCSF containing membrane impermeable acid at pH 5.5 and then returned to pH 7.4. e, Quantification of GluA2(Q)-SEP puncta intensities before, during and after acidic aCSF exposure, as a ratio to PSD95-RFP puncta intensity ( n = 4 puncta, one cell). f , confocal images of two representative GluA2(Q)-SEP; PSD95-RFP, TAG-BFP expressing glioma cells in co-culture with neurons. Co-localized puncta intensity was measured over a time course with BDNF (100nM) perfusion. g, Left, quantification of GluA2(Q)-SEP / PSD95-RFP puncta intensities over time with BDNF as compared to initial baseline intensity ( n = 8 puncta, 6 cells). Right, quantification of one 15-minute time point with control cells (vehicle, n = 4 puncta, 2 cells) vs BDNF treatment (100nM, n = 8 puncta, 6 cells). h, Representative Western blot analysis of primary patient-derived glioma culture, SU-DIPGVI, treated with 100nM recombinant BDNF at several timepoints using indicated antibodies. Right, quantification of the phospho-immunoblots ratio to corresponding total protein levels and normalized to vehicle treated control ( y axis is in arbitrary units, n = 3 biological replicates). i , Representative Western blot analysis of 100nM BDNF treated glioma cells (as in h ,) at 30mins with and without entrectinib (5µM). Right, quantification of phospho-immunoblots (as in h , y axis is in arbitrary units, n = 3 biological replicates). Data are mean ± s.e.m. *P< 0.05, **P< 0.01, two-tailed paired Student’s t -test for b , e , One sample t and Wilcoxon test for g (left panel), h and i . Unpaired t-test for g (right panel).

Journal: bioRxiv

Article Title: Glioma synapses recruit mechanisms of adaptive plasticity

doi: 10.1101/2021.11.04.467325

Figure Lengend Snippet: a , Schematic depicting AMPAR channel trafficking downstream of BDNF-TrkB signaling. BDNF-TrkB induces activation of Ca 2+ /calmodulin-dependent kinase II (CAMKII) and protein kinase C (PKC), which phosphorylates AMPAR subunits and increases synaptic delivery . b , Western blot analysis of cell membrane surface and total cell protein from SU-DIPGVI cells treated with 100nM BDNF for 30mins. Surface proteins were labelled with Biotin and extracted from total protein with Avidin bead pull-down. Right, quantification of % of biotinylated cell surface proteins from total ( n = 4 biological replicates). c, Super ecliptic pHluorin tagged GluA subunit (GluA-SEP). d-e, Validation of pHluorin. d, Left, confocal image of a glioma cell expressing the calcium permeable AMPAR subunit tagged with SEP (GluA2(Q)-SEP), PSD95-RFP and whole cell TagBFP, in co-culture with neurons. Right, individual representative puncta of GluA2(Q)-SEP. Scale bars = 5µm and 1µm, respectively. Cells were perfused with pH 7.4 aCSF followed by exposure to aCSF containing membrane impermeable acid at pH 5.5 and then returned to pH 7.4. e, Quantification of GluA2(Q)-SEP puncta intensities before, during and after acidic aCSF exposure, as a ratio to PSD95-RFP puncta intensity ( n = 4 puncta, one cell). f , confocal images of two representative GluA2(Q)-SEP; PSD95-RFP, TAG-BFP expressing glioma cells in co-culture with neurons. Co-localized puncta intensity was measured over a time course with BDNF (100nM) perfusion. g, Left, quantification of GluA2(Q)-SEP / PSD95-RFP puncta intensities over time with BDNF as compared to initial baseline intensity ( n = 8 puncta, 6 cells). Right, quantification of one 15-minute time point with control cells (vehicle, n = 4 puncta, 2 cells) vs BDNF treatment (100nM, n = 8 puncta, 6 cells). h, Representative Western blot analysis of primary patient-derived glioma culture, SU-DIPGVI, treated with 100nM recombinant BDNF at several timepoints using indicated antibodies. Right, quantification of the phospho-immunoblots ratio to corresponding total protein levels and normalized to vehicle treated control ( y axis is in arbitrary units, n = 3 biological replicates). i , Representative Western blot analysis of 100nM BDNF treated glioma cells (as in h ,) at 30mins with and without entrectinib (5µM). Right, quantification of phospho-immunoblots (as in h , y axis is in arbitrary units, n = 3 biological replicates). Data are mean ± s.e.m. *P< 0.05, **P< 0.01, two-tailed paired Student’s t -test for b , e , One sample t and Wilcoxon test for g (left panel), h and i . Unpaired t-test for g (right panel).

Article Snippet: The SEP fragment with Gibson overhangs was amplified from Addgene plasmid pCI-SEP-GluR2(Q) (#24002) with primers: 5’-AACGGGTTTGCCGCCAGAACACAGGACCGGTGCCACCATGCAAAAGATTATGCAT ATTTC and 5’-CCCCCTATCTGTATGCTGTTGCTAGCTTTGTATAGTTCATC.

Techniques: Activation Assay, Western Blot, Avidin-Biotin Assay, Expressing, Co-Culture Assay, Derivative Assay, Recombinant, Two Tailed Test